Modification:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Recombinant:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Concentration Assay:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Formalin-fixed Paraffin-Embedded:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Isolation:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Multiplex Assay:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Size Selection:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
Gene Expression:Article Title: In situ multi-modal characterization of pancreatic cancer reveals tumor cell identity as a defining factor of the surrounding microenvironment.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Treatment naive human resected PDAC tumors Oxford Radcliffe biobank 09/H0606/5 + 5, project: 19/A177, REC: NRES Committee South Central - Oxford C Treatment naive human resected PDAC tumors Aachen medical center RWTH Aachen biobank project: EK360/19 Treatment naive human resected PDAC tumors BioIVT N/A Treatment naive human resected PDAC tumors Discovery Life Sciences N/A Treatment naive human resected PDAC tumors BMS N/A KP2 subcutaneous tumors BMS N/A Chemicals, peptides, and recombinant proteins TissueTek O.C.T. .. Compound Sakura Cat# 4583 RPMI with 1X Glutamax ThermoFisher Scientific Cat# 35050061 ATCC modified RPMI ThermoFisher Scientific Cat# A1049101 DMEM ThermoFisher Scientific Cat# 11965092 KFSM ThermoFisher Scientific Cat# 10744019 1 M HEPES ThermoFisher Scientific Cat# 72400047 100 mM Sodium Pyruvate ThermoFisher Scientific Cat# 11360070 Fetal Bovine Serum ThermoFisher Scientific Cat# 16000044 Pen-Strep ThermoFisher Scientific Cat# 15140122 Insulin, human recombinant, zinc solution ThermoFisher Scientific Cat# 12585014 BioCoat Collagen I 150 mm TC-treated Culture Dishes Corning Cat# 354551 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Superfrost Plus slides Fisher Scientific Cat# 12-550-15 Buffer EB Qiagen Cat# 19086 Critical commercial assays RNA ScreenTape Agilent Cat# 5067-5576 PureLink FFPE RNA Isolation Kit ThermoFisher Scientific Cat# K156002 Zymo Direct-zol RNA Microprep Zymo Cat# R2061 DNA Clean & Concentrator-5 Zymo Cat# D4013 Template Switching RT Enzyme Mix NEB Cat# M0466L Deoxynucleotide (dNTP) Solution Mix NEB Cat# N0447L Monarch RNaseA NEB Cat# T3018L NEBNext Ultra II Q5 Master Mix NEB Cat# M0544L NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) NEB Cat# E7335L LunaScript RT Master Mix Kit (Primer-free) NEB Cat# E3025S Q5 Hot Start High-Fidelity 2X Master Mix NEB Cat# M0494 2000X EvaGreen Dye VWR Cat# 76423-472 SPRIselect DNA Size Selection Reagent Beckman Coulter Cat# B23319 Visium Spatial Gene Expression Slide & Reagents Kit, 16 rxns 10X Genomics Cat# 1000184 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome, 16 rxns 10X Genomics Cat# 1000336 NextSeq 2000 P3 Reagents (200 Cycles) Illumina Cat# 20040560 (Continued on next page) 28 Cell Reports 45, 116827, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER NextSeq 2000 P3 Reagents (100 Cycles) Illumina Cat# 20074933 NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) Illumina Cat# 20028313 CosMx TM Human Universal Cell Characterization Panel, 1000-plex RNA probe set Nanostring Cat# CMX-H-USCP-1KP-R CosMx Custom addon probeset - CEACAM5, FERMT1, LGALS4, LOX, NT5R, SLC5A3, TFF1, TFF3, TNS4, and TSPAN8 Nanostring N/A Deposited data Raw and analyzed sequencing data for RNAseq lite This paper GSE310388 Raw and analyzed sequencing data for Visium This paper GSE282302 CosMx data This paper GSE310352 Code and data for BMS Spatial Portal This paper https://doi.org/10.5281/zenodo.17817567 Code for distance to tumor and deposited collagen modeling This paper https://doi.org/10.5281/zenodo.17817587 Code for AirFlow enabled implementation of the filtering and normalization logic for low-bulk spatial data This paper https://doi.org/10.5281/zenodo.17817599 Code for transcriptomic-pathology integration This paper https://doi.org/10.5281/zenodo.17817587 icWGCNA Mason 204 https://doi.org/10.5281/zenodo.17818928 Experimental models: Cell lines Mouse: KP2 Washington University School of Medicine, St Louis, MO N/A Human: Panc0203 ATCC RRID: CVCL_1633 Human: Panc0403 ATCC RRID: CVCL_1636 Human: AsPC1 ATCC RRID: CVCL_0152 Human: Panc-1 ATCC RRID: CVCL_0480 Human: PACADD-188 ATCC RRID: CVCL_M469 Experimental models: Organisms/strains Mice, C57BL/6 (female aged 7–8 weeks) Charles River RRID: IMSR_JAX:000664 Oligonucleotides KRAS_ampseq_RT: GAAAGCCCTCCCCAGTCCTC This paper N/A KRAS_ampseq_F: ACACTCTTTCCCTAC ACGACGCTCTTCCGATCTGGAGAGAG GCCTGCTGAAAA This paper N/A KRAS_ampseq_R: GTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTACTGG TCCCTCATTGCACTG This paper N/A RNA-lite_RT-primer: GTGACTGGAGTT CAGACGTGTGCTCTTCCGATCT [T] 30 VN This paper N/A RNA-lite_TSO:ACACTCTTTCCCTACAC GACGCTCTTCCGATCT[Sample Index] 8 [UMI(N)] 8 [Stagger] 0-8 rGrGrG This paper N/A Software and algorithms HALO-AI v3.4 Indica Labs https://indicalab.com/halo SpaceRanger v2.1.1 10X Genomics https://www.10xgenomics.com/ support/software/space-ranger SpotClean Ni et al. 205 https://github.com/zijianni/SpotClean SCTransform v2 Hafemeister and Satija 206 https://github.com/satijalab/sctransform Harmony Korsunksy et al. 207 https://github.com/immunogenomics/harmony Seurat v5 Hao et al. 208 https://satijalab.org/seurat/ (Continued on next page) Cell Reports 45, 116827, January 27, 2026 29
|
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 